Ectodermal appendages such as hair, feather and tooth are attractive
models for understanding the mechanisms underlying epithelialmesenchymal
interactions (Thesleff et al., 1995; Mikkola and Millar,
2006). A series of signaling molecules is involved in each step of
primary hair development and differentiation. Wnt signaling is
crucial for the initiation of hair follicle (hf) development (Andl et al.,
2002), and Shh controls proliferation of the epithelial hair germ
(Chiang et al., 1999). Noggin, BMP and ectodysplasin (Eda)
signaling play important roles at early stages of hf placode
development (Botchkarev et al., 1999; Mou et al., 2006; SchmidtUllrich
et al., 2006; Pummila et al., 2007). The dermal papilla (DP)
remains associated with the overlying epithelial matrix cells, which
undergo an upward differentiation process to give rise to the
different hf lineages such as the medulla, cortex and cuticle of the
hair shaft and the inner root sheath (IRS) (Millar, 2002; Fuchs,
2007). The matrix is derived from epithelial stem cells located in the
bulge region of the hf (Cotsarelis et al., 1990; Taylor et al., 2000;
Oshima et al., 2001; Levy et al., 2005). Several important pathways
and transcription factors that initiate and promote differentiation of
the matrix cells have been determined, including Gata3 and Cutl
[which regulate IRS differentiation (Ellis et al., 2001; Kaufman et
al., 2003; Kurek et al., 2007)] and BMP signaling, and transcription
factors such as Msx2, Foxn1 and Hoxc13 that are required for hair
shaft differentiation (Godwin and Capecchi, 1998; Meier et al.,
1999; Kulessa et al., 2000; Tkatchenko et al., 2001; Ma et al., 2003;
Johns et al., 2005).
After early follicle morphogenesis, the hf undergoes cyclic transformations known as anagen (growth phase), catagen (regression) and telogen (resting phase), allowing the study of essential stages of proliferation and differentiation (Schmidt-Ullrich and Paus, 2005). Cyclical renewal of the hair is thought to recapitulate some of the signaling and control mechanisms found between the DP and overlying epithelial cells during the embryonic onset of hair formation (Oliver and Jahoda, 1988; Hardy, 1992; Schmidt-Ullrich and Paus, 2005). Several of the transcription factors with distinct and important roles in the developing hf are homeobox-containing proteins such as Msx2, Lhx2 and Hoxc13 (Godwin and Capecchi, 1998; Tkatchenko et al., 2001; Ma et al., 2003; Rhee et al., 2006). Homeodomain transcription factors play crucial roles in many developmental processes, ranging from organization of the body plan to differentiation of individual tissues. Dlx3 belongs to the Dlx family of homeodomain transcription factors (Dlx1-6). In the genome, they are organized into three pairs of inverted, convergently transcribed genes, termed Dlx1-2, Dlx3-4 and Dlx5-6 (Morasso and Radoja, 2005).
Dlx3 has an essential role in epidermal, osteogenic and placental development (Morasso et al., 1996; Morasso et al., 1999; Beanan and Sargent, 2000; Hassan et al., 2004). Importantly, an autosomal dominant mutation in DLX3 is responsible for the ectodermal dysplasia termed Tricho-Dento-Osseous syndrome (TDO), which is characterized by defects in teeth and bone development, and abnormalities in hair shaft morphology and diameter (Price et al., 1998; Wright et al., 2008). Despite strong evidence suggesting a major role for Dlx3 in epithelial appendage and hf development, early lethality of loss-of-function mutants have precluded the analysis of the specific function of Dlx3 in these processes (Morasso et al., 1999). Taking advantage of a Dlx3Kin/+ line that has the β-galactosidase (lacZ) gene inserted into the Dlx3 locus, we present a thorough analysis of the broad Dlx3 expression during the hair cycle. Using a K14cre line that expresses the Cre recombinase in epidermal cells and their derivatives (Andl et al., 2004), and a floxed Dlx3 line, we determined the role of Dlx3 in hair development by epidermal-specific ablation. The most striking defects in the conditional knockout mice were complete alopecia owing to a failure in hf development, concomitant with lack of expression of transcriptional regulators necessary for the differentiation of the IRS and hair shaft, and inability to undergo cyclic regeneration postnatally. Our results demonstrate that loss of ectodermal Dlx3 leads to altered morphogenesis, differentiation and cycling of the hfs. Taken together with the pathological conditions of individuals with TDO, these results establish Dlx3 as a crucial regulator of hair development.
MATERIALS AND METHODS Gene targeting and generation of mutants The targeting vector for the Dlx3Kin/+ line was derived from the vector pZINI (nM) containing the β-galactosidase (lacZ) gene as a reporter. A 3.9 kb NotIBamHI 5 genomic flank, which corresponds to the region directly upstream of Dlx3 exon1, was cloned upstream of lacZ gene (Fig. 1A). The 4.3 kb 3 homologous flank was subcloned downstream of neomycin gene in pZINI. The targeting vector for the Dlx3 floxed (Dlx3f/f) line contains 6.5 kb of Dlx3 genomic sequence from a 129/Sv strain in the pPNT vector (Fig. 3A). This construct was modified by inserting a loxP site immediately downstream of the neomycin gene (Neo). A second loxP site was inserted into the unique NotI site (N) between the first and second exons of the Dlx3 gene. Genotype of the Dlx3Kin/+ mouse line was determined by Southern blot analysis and PCR (Fig. 1A). Three oligonucleotides were used for the genotyping by PCR: PCRforward Dlx3Kin/+ primer (GGGTCTTTGCCACTTTCTGTCTGTCATTTGCATAGA) is located 449 bp upstream from the transcription start site of the Dlx3 gene; for determination of the wild-type allele, we utilized PCRreverse1 Dlx3Kin/+ (CCTGCGAGCCCATTGAGATTGAACTGGTGGTGGTAG), which is located 432 bp downstream from the transcription start site located on Exon 1, and generates a 880 bp fragment; and for the determination of the lacZ knockin allele, we used PCRforward Dlx3Kin/+ primer (same as above) and PCRreverse2 Dlx3Kin/+ (TGAAACGCTGGGCAATATCGCGGCTCAG - TTCG) located 280 bp downstream from the transcription start site of lacZ gene and generates a 730 bp fragment. The cycling conditions were: 94°C for 5 minutes followed by 30 cycles of 94°C for 30 seconds, 60°C for 30 seconds and 72°C for 1 minute. For the Dlx3f/f line, recombination was determined by Southern blot (Fig. 3A). For the epidermal-specific ablation of Dlx3, we used a K14cre line that has been previously characterized (Andl et al., 2004). The Cre-mediated deletion of Dlx3 to generate the K14cre;Dlx3Kin/f or K14cre;Dlx3f/f was assessed by PCR with the following oligonucleotides: PCRforward Dlx3Kin/+ primer and PCRreverse-cre primer (TGTAAGGTGT - GTCATTTTCCTCAACGGGTG) generating a 2.15 kb fragment (Fig. 3C). The cycling conditions were: 94°C for 5 minutes followed by 35 cycles of 94°C for 30 seconds, 60°C for 30 seconds and 68°C for 4 minutes. Throughout this study, the K14cre;Dlx3Kin/f or K14cre;Dlx3f/f lines were analyzed obtaining similar results. All animal work was approved by the NIAMS Animal Care and Use Committee.
X-gal staining and treatment with benzyl-benzoate/benzyl alcohol X-gal staining of Dlx3Kin/+ whole embryos or individual dissected organs was performed with 1 mg/ml 5-Br-4-Cl-3-indolyl-β-D-galactosidase (Xgal), 5 mM potassium ferricyanide, 5 mM potassium ferrocyanide and 2 mM MgCl2 in PBS and the detergent NP-40 (0.02%). Samples were fixed at 4°C in 4% paraformaldehyde/PBS. X-gal stained Dlx3Kin/+ embryos were cleared by treatment with benzyl-benzoate/benzyl alcohol 2:1 mixture after dehydration in methanol. Histology, immunofluorescence and confocal microscopy Skin sections (10 μm) were stained with either primary antibodies overnight at 4°C for immunofluorescent staining or Hematoxylin/Eosin. The antibodies and dilutions used were anti-Dlx3 (1:250, Morasso Laboratory) (Bryan and Morasso, 2000), anti-β-galactosidase (1:250, Abcam), antiPCNA (1:100, Calbiochem), anti-β-catenin (1:200, Sigma), anti-PhosphoSmad1/5/8 (1:50, Cell Signaling Technology), anti-Lef1 (1:100, Cell Signaling Technology), anti-Hoxc13 (1:50, Novus Biologicals), anti-Gata3 (1:100, Santa Cruz), anti-AE13 (type I hair keratin, 1:10, gift from T. T. Sun), anti-AE15 (trichohyalin, 1:10, gift from T. T. Sun), anti-adipophilin (1:100, Fitzgerald), anti-K1 (1:500, Covance), anti-K10 (1:500, Covance), anti-K15 (1:100, Thermo Scientific), anti-K17 (1:1000, gift from P. Coulombe), anti-K35 (previous nomenclature Ha5) and anti-K85 (previous nomenclature Hb5) (1:50, Progen) and secondary antibodies: Alexa Fluor 488 or Alexa Fluor 546 goat anti-mouse, rabbit, chicken or guinea pig IgG (1:250, Molecular Probes). MOM immunodetection kit and antigen unmasking solutions (Vector Laboratories) were used to reduce background staining if applicable. The slides were mounted with Vector Shield (Vector Laboratories) and examined using laser-scanning confocal microscope 510 Meta (Zeiss). Hair follicle cell preparation and western blot analysis Primary mouse hf cells were isolated from the dermis of mouse skins by Ficoll density gradient centrifugation after treatment with collagenase 0.35% and DNase 250 units/ml. Protein samples from hf cells were subjected to western blot analysis. The antibodies and dilutions used: anti-Dlx3 (1:1000, Morasso laboratory), anti-K35 (1:1000, Progen) and anti-α-tubulin (1:2000, Abcam). The immunoreactive proteins were detected using the horseradish peroxidase-linked secondary antibody (Vector Laboratories). Cloning, cell culture, transfection and reporter assays The –1055 to +134 bp DNA fragment of the K35 promoter was inserted into the pGL3-Basic vector (Promega). Site-directed mutations of putative Dlx3 binding sites on the K35 promoter were performed using the ExSitePCRbased site-directed mutagenesis kit (Stratagene). The V5-tagged Dlx3 was cloned into the pCI-neo vector (Promega). Transformed PAM212 mouse keratinocytes (Yuspa et al., 1980) were cotransfected with 1 μg of each construct using FuGENE 6 transfection reagent (Roche) (Hwang et al., 2007). Luciferase activity was measured 24-36 hours after the transfection using the Dual-Luciferase Reporter Assay System (Promega). The pRL-TK vector was also co-transfected as an internal control for the assay. Each transfection was carried out in duplicate and the experiment was repeated three times.
Chromatin immunoprecipitation (ChIP) assays Primary mouse hf cells or transfected hf cells with pCI-neo-V5-Dlx3 construct were used for ChIP assays (Radoja et al., 2007). Chromatin was incubated with control anti-mouse IgG, anti-Lef1, anti-Dlx3 (Abnova) or anti-V5 antibody (Serotec) overnight at 4°C. The samples were eluted after washing and PCR reactions were performed by sets of specific primers: hair keratin K32 (previous nomenclature Ha2), GGCAACACAGGACAGGCTATGGCAG (forward), CATGGGGGAGTGTTG - ATGTTTATACTTGGCCCC (reverse); hair keratin K35, ACG - GGGCTTCTGTTTTACGAGGCCGG (forward), CCCTAGCCCGACT - TTATACTTCTGCCCCA (reverse); Hoxc13, GTTAGGG GAG - GGGGGCAGAGAGGCTTAATTTGG (forward), TACCGAAGTCTCTAAATTGGGGCTTGG (reverse); Dlx3, GTGTGTGTGTGTGTGTGTGTGTGTGTATTAGGGGTA (forward), CGTGCCTCTCTCCGCGTCCCAAGCCACAGTCAAATG (reverse); GAPDH, TACTAGCGGTTTTACGGGCG (forward), TCGAACAGGAGGAGCAGAGAGCGA (reverse). Electrophoretic mobility shift (EMSA) and supershift assays EMSA was performed as described by Feledy et al. (Feledy et al., 1999). For supershift assays, primary mouse hf cells were isolated as described above. Nuclear extracts were prepared according to the manufacturer’s instructions (Active Motif).
After early follicle morphogenesis, the hf undergoes cyclic transformations known as anagen (growth phase), catagen (regression) and telogen (resting phase), allowing the study of essential stages of proliferation and differentiation (Schmidt-Ullrich and Paus, 2005). Cyclical renewal of the hair is thought to recapitulate some of the signaling and control mechanisms found between the DP and overlying epithelial cells during the embryonic onset of hair formation (Oliver and Jahoda, 1988; Hardy, 1992; Schmidt-Ullrich and Paus, 2005). Several of the transcription factors with distinct and important roles in the developing hf are homeobox-containing proteins such as Msx2, Lhx2 and Hoxc13 (Godwin and Capecchi, 1998; Tkatchenko et al., 2001; Ma et al., 2003; Rhee et al., 2006). Homeodomain transcription factors play crucial roles in many developmental processes, ranging from organization of the body plan to differentiation of individual tissues. Dlx3 belongs to the Dlx family of homeodomain transcription factors (Dlx1-6). In the genome, they are organized into three pairs of inverted, convergently transcribed genes, termed Dlx1-2, Dlx3-4 and Dlx5-6 (Morasso and Radoja, 2005).
Dlx3 has an essential role in epidermal, osteogenic and placental development (Morasso et al., 1996; Morasso et al., 1999; Beanan and Sargent, 2000; Hassan et al., 2004). Importantly, an autosomal dominant mutation in DLX3 is responsible for the ectodermal dysplasia termed Tricho-Dento-Osseous syndrome (TDO), which is characterized by defects in teeth and bone development, and abnormalities in hair shaft morphology and diameter (Price et al., 1998; Wright et al., 2008). Despite strong evidence suggesting a major role for Dlx3 in epithelial appendage and hf development, early lethality of loss-of-function mutants have precluded the analysis of the specific function of Dlx3 in these processes (Morasso et al., 1999). Taking advantage of a Dlx3Kin/+ line that has the β-galactosidase (lacZ) gene inserted into the Dlx3 locus, we present a thorough analysis of the broad Dlx3 expression during the hair cycle. Using a K14cre line that expresses the Cre recombinase in epidermal cells and their derivatives (Andl et al., 2004), and a floxed Dlx3 line, we determined the role of Dlx3 in hair development by epidermal-specific ablation. The most striking defects in the conditional knockout mice were complete alopecia owing to a failure in hf development, concomitant with lack of expression of transcriptional regulators necessary for the differentiation of the IRS and hair shaft, and inability to undergo cyclic regeneration postnatally. Our results demonstrate that loss of ectodermal Dlx3 leads to altered morphogenesis, differentiation and cycling of the hfs. Taken together with the pathological conditions of individuals with TDO, these results establish Dlx3 as a crucial regulator of hair development.
MATERIALS AND METHODS Gene targeting and generation of mutants The targeting vector for the Dlx3Kin/+ line was derived from the vector pZINI (nM) containing the β-galactosidase (lacZ) gene as a reporter. A 3.9 kb NotIBamHI 5 genomic flank, which corresponds to the region directly upstream of Dlx3 exon1, was cloned upstream of lacZ gene (Fig. 1A). The 4.3 kb 3 homologous flank was subcloned downstream of neomycin gene in pZINI. The targeting vector for the Dlx3 floxed (Dlx3f/f) line contains 6.5 kb of Dlx3 genomic sequence from a 129/Sv strain in the pPNT vector (Fig. 3A). This construct was modified by inserting a loxP site immediately downstream of the neomycin gene (Neo). A second loxP site was inserted into the unique NotI site (N) between the first and second exons of the Dlx3 gene. Genotype of the Dlx3Kin/+ mouse line was determined by Southern blot analysis and PCR (Fig. 1A). Three oligonucleotides were used for the genotyping by PCR: PCRforward Dlx3Kin/+ primer (GGGTCTTTGCCACTTTCTGTCTGTCATTTGCATAGA) is located 449 bp upstream from the transcription start site of the Dlx3 gene; for determination of the wild-type allele, we utilized PCRreverse1 Dlx3Kin/+ (CCTGCGAGCCCATTGAGATTGAACTGGTGGTGGTAG), which is located 432 bp downstream from the transcription start site located on Exon 1, and generates a 880 bp fragment; and for the determination of the lacZ knockin allele, we used PCRforward Dlx3Kin/+ primer (same as above) and PCRreverse2 Dlx3Kin/+ (TGAAACGCTGGGCAATATCGCGGCTCAG - TTCG) located 280 bp downstream from the transcription start site of lacZ gene and generates a 730 bp fragment. The cycling conditions were: 94°C for 5 minutes followed by 30 cycles of 94°C for 30 seconds, 60°C for 30 seconds and 72°C for 1 minute. For the Dlx3f/f line, recombination was determined by Southern blot (Fig. 3A). For the epidermal-specific ablation of Dlx3, we used a K14cre line that has been previously characterized (Andl et al., 2004). The Cre-mediated deletion of Dlx3 to generate the K14cre;Dlx3Kin/f or K14cre;Dlx3f/f was assessed by PCR with the following oligonucleotides: PCRforward Dlx3Kin/+ primer and PCRreverse-cre primer (TGTAAGGTGT - GTCATTTTCCTCAACGGGTG) generating a 2.15 kb fragment (Fig. 3C). The cycling conditions were: 94°C for 5 minutes followed by 35 cycles of 94°C for 30 seconds, 60°C for 30 seconds and 68°C for 4 minutes. Throughout this study, the K14cre;Dlx3Kin/f or K14cre;Dlx3f/f lines were analyzed obtaining similar results. All animal work was approved by the NIAMS Animal Care and Use Committee.
X-gal staining and treatment with benzyl-benzoate/benzyl alcohol X-gal staining of Dlx3Kin/+ whole embryos or individual dissected organs was performed with 1 mg/ml 5-Br-4-Cl-3-indolyl-β-D-galactosidase (Xgal), 5 mM potassium ferricyanide, 5 mM potassium ferrocyanide and 2 mM MgCl2 in PBS and the detergent NP-40 (0.02%). Samples were fixed at 4°C in 4% paraformaldehyde/PBS. X-gal stained Dlx3Kin/+ embryos were cleared by treatment with benzyl-benzoate/benzyl alcohol 2:1 mixture after dehydration in methanol. Histology, immunofluorescence and confocal microscopy Skin sections (10 μm) were stained with either primary antibodies overnight at 4°C for immunofluorescent staining or Hematoxylin/Eosin. The antibodies and dilutions used were anti-Dlx3 (1:250, Morasso Laboratory) (Bryan and Morasso, 2000), anti-β-galactosidase (1:250, Abcam), antiPCNA (1:100, Calbiochem), anti-β-catenin (1:200, Sigma), anti-PhosphoSmad1/5/8 (1:50, Cell Signaling Technology), anti-Lef1 (1:100, Cell Signaling Technology), anti-Hoxc13 (1:50, Novus Biologicals), anti-Gata3 (1:100, Santa Cruz), anti-AE13 (type I hair keratin, 1:10, gift from T. T. Sun), anti-AE15 (trichohyalin, 1:10, gift from T. T. Sun), anti-adipophilin (1:100, Fitzgerald), anti-K1 (1:500, Covance), anti-K10 (1:500, Covance), anti-K15 (1:100, Thermo Scientific), anti-K17 (1:1000, gift from P. Coulombe), anti-K35 (previous nomenclature Ha5) and anti-K85 (previous nomenclature Hb5) (1:50, Progen) and secondary antibodies: Alexa Fluor 488 or Alexa Fluor 546 goat anti-mouse, rabbit, chicken or guinea pig IgG (1:250, Molecular Probes). MOM immunodetection kit and antigen unmasking solutions (Vector Laboratories) were used to reduce background staining if applicable. The slides were mounted with Vector Shield (Vector Laboratories) and examined using laser-scanning confocal microscope 510 Meta (Zeiss). Hair follicle cell preparation and western blot analysis Primary mouse hf cells were isolated from the dermis of mouse skins by Ficoll density gradient centrifugation after treatment with collagenase 0.35% and DNase 250 units/ml. Protein samples from hf cells were subjected to western blot analysis. The antibodies and dilutions used: anti-Dlx3 (1:1000, Morasso laboratory), anti-K35 (1:1000, Progen) and anti-α-tubulin (1:2000, Abcam). The immunoreactive proteins were detected using the horseradish peroxidase-linked secondary antibody (Vector Laboratories). Cloning, cell culture, transfection and reporter assays The –1055 to +134 bp DNA fragment of the K35 promoter was inserted into the pGL3-Basic vector (Promega). Site-directed mutations of putative Dlx3 binding sites on the K35 promoter were performed using the ExSitePCRbased site-directed mutagenesis kit (Stratagene). The V5-tagged Dlx3 was cloned into the pCI-neo vector (Promega). Transformed PAM212 mouse keratinocytes (Yuspa et al., 1980) were cotransfected with 1 μg of each construct using FuGENE 6 transfection reagent (Roche) (Hwang et al., 2007). Luciferase activity was measured 24-36 hours after the transfection using the Dual-Luciferase Reporter Assay System (Promega). The pRL-TK vector was also co-transfected as an internal control for the assay. Each transfection was carried out in duplicate and the experiment was repeated three times.
Chromatin immunoprecipitation (ChIP) assays Primary mouse hf cells or transfected hf cells with pCI-neo-V5-Dlx3 construct were used for ChIP assays (Radoja et al., 2007). Chromatin was incubated with control anti-mouse IgG, anti-Lef1, anti-Dlx3 (Abnova) or anti-V5 antibody (Serotec) overnight at 4°C. The samples were eluted after washing and PCR reactions were performed by sets of specific primers: hair keratin K32 (previous nomenclature Ha2), GGCAACACAGGACAGGCTATGGCAG (forward), CATGGGGGAGTGTTG - ATGTTTATACTTGGCCCC (reverse); hair keratin K35, ACG - GGGCTTCTGTTTTACGAGGCCGG (forward), CCCTAGCCCGACT - TTATACTTCTGCCCCA (reverse); Hoxc13, GTTAGGG GAG - GGGGGCAGAGAGGCTTAATTTGG (forward), TACCGAAGTCTCTAAATTGGGGCTTGG (reverse); Dlx3, GTGTGTGTGTGTGTGTGTGTGTGTGTATTAGGGGTA (forward), CGTGCCTCTCTCCGCGTCCCAAGCCACAGTCAAATG (reverse); GAPDH, TACTAGCGGTTTTACGGGCG (forward), TCGAACAGGAGGAGCAGAGAGCGA (reverse). Electrophoretic mobility shift (EMSA) and supershift assays EMSA was performed as described by Feledy et al. (Feledy et al., 1999). For supershift assays, primary mouse hf cells were isolated as described above. Nuclear extracts were prepared according to the manufacturer’s instructions (Active Motif).







